Browse Questions » Anthropology

Have a favorite subject? Get browsing, and start earning cash! You're currently viewing new and expired questions. Want to only show new questions?

Pick a subcategory.


Here's the questions in Anthropology. Go get 'em! 1-20 of 72 | Next
Bounty Status Sub-CategoryQuestion Due
$1.00 Unanswered General Anthropology need tutor
Need Tutor
Nov. 24, 2009
$1.00 Closed Cultural Anthropology Consumption And Exchange
Native Americans of Northwest Coast , such as the Kwakwaka 'wakw of Canada , were prodominantly foragers , yet they often accumulated surplus goods and participated in lavish feasts and competitive...
Nov. 20, 2009
$1.00 Closed General Anthropology »»»»»ETH/125__Need Syllabus!
Looking for a 2009 copy of ETH/125 CULTURAL DIVERSITY Syllabus   Preferably from Sept/Oct/Nov 2009 with the new 4-day discussion requirements
Nov. 19, 2009
$0.25 Closed General Anthropology oooooopppppps
Oooooooooppps
Nov. 17, 2009
$125.00 Closed General Anthropology Benjamin
This is for Benjamin only!!!
Nov. 14, 2009
$15.00 Closed General Anthropology Helper
Neeed some help
Oct. 28, 2009
$10.00 Closed General Anthropology JAVASTUDENT
Need tutor help from Javstudent
Oct. 17, 2009
$1.00 Closed General Anthropology plese help me
what can i do in my graduate life ?
Oct. 17, 2009
$10.00 Closed General Anthropology Gph Help
Need help
Oct. 01, 2009
$1.00 Closed General Anthropology HUM/105 World Mythology
Anyone has taken HUM 105 / world mythology????
Oct. 01, 2009
$0.25 Closed Cultural Anthropology NATIVE AMERICANS OF THE NORTHWEST COAST
WHERE DO THE KWAKWAKA'WAKW OF CANADA FIT ON THE CONTINUUMS OF PRODUCTION, CONSUMPTION, AND EXCHANGE?
Oct. 01, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed Cultural Anthropology Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn...
Sep. 20, 2009
$1.00 Closed General Anthropology what is the original dna code for - cuga
what is the original dna code for - cugacauucgacuaccguaguguc?
Sep. 20, 2009
$25.00 Closed General Anthropology question for aulii123
question for aulii123
Sep. 19, 2009
$16.39 Closed General Anthropology Heretohelpyou88 .. this is for you.
Heretohelpyou88 .. this is for you.
Sep. 16, 2009
   
Join Now or Log In
Get Tutoring
Get Paid
Academic Honesty