![]() |
Browse Questions » AnthropologyHave a favorite subject? Get browsing, and start earning cash! You're currently viewing new and expired questions. Want to only show new questions? |
Pick a subcategory.
- Archaeology
- Cultural Anthropology (20)
- General Anthropology (47)
- Physical Anthropology (5)
- Psychological Anthropology
- Sex and Gender (1)
| Here's the questions in Anthropology. Go get 'em! 1-20 of 72 | Next | ||||
| Bounty | Status | Sub-Category | Question | Due |
|---|---|---|---|---|
| $1.00 | Unanswered | General Anthropology | need tutor
Need Tutor |
Nov. 24, 2009 |
| $1.00 | Closed | Cultural Anthropology | Consumption And Exchange
Native Americans of Northwest Coast , such as the Kwakwaka 'wakw of Canada , were prodominantly foragers , yet they often accumulated surplus goods and participated in lavish feasts and competitive... |
Nov. 20, 2009 |
| $1.00 | Closed | General Anthropology | »»»»»ETH/125__Need Syllabus!
Looking for a 2009 copy of ETH/125 CULTURAL DIVERSITY Syllabus Preferably from Sept/Oct/Nov 2009 with the new 4-day discussion requirements |
Nov. 19, 2009 |
| $0.25 | Closed | General Anthropology | oooooopppppps
Oooooooooppps |
Nov. 17, 2009 |
| $125.00 | Closed | General Anthropology | Benjamin
This is for Benjamin only!!! |
Nov. 14, 2009 |
| $15.00 | Closed | General Anthropology | Helper
Neeed some help |
Oct. 28, 2009 |
| $10.00 | Closed | General Anthropology | JAVASTUDENT
Need tutor help from Javstudent |
Oct. 17, 2009 |
| $1.00 | Closed | General Anthropology | plese help me
what can i do in my graduate life ? |
Oct. 17, 2009 |
| $10.00 | Closed | General Anthropology | Gph Help
Need help |
Oct. 01, 2009 |
| $1.00 | Closed | General Anthropology | HUM/105 World Mythology
Anyone has taken HUM 105 / world mythology???? |
Oct. 01, 2009 |
| $0.25 | Closed | Cultural Anthropology | NATIVE AMERICANS OF THE NORTHWEST COAST
WHERE DO THE KWAKWAKA'WAKW OF CANADA FIT ON THE CONTINUUMS OF PRODUCTION, CONSUMPTION, AND EXCHANGE? |
Oct. 01, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | Cultural Anthropology | Psychological anthropology is the study
Psychological anthropology is the study of individuals and their personalities and identities, within particular cultural contexts" identify two different cultures int he world. I would like to learn... |
Sep. 20, 2009 |
| $1.00 | Closed | General Anthropology | what is the original dna code for - cuga
what is the original dna code for - cugacauucgacuaccguaguguc? |
Sep. 20, 2009 |
| $25.00 | Closed | General Anthropology | question for aulii123
question for aulii123 |
Sep. 19, 2009 |
| $16.39 | Closed | General Anthropology | Heretohelpyou88 .. this is for you.
Heretohelpyou88 .. this is for you. |
Sep. 16, 2009 |



